this post was submitted on 08 Apr 2025
121 points (99.2% liked)
chapotraphouse
13784 readers
915 users here now
Banned? DM Wmill to appeal.
No anti-nautilism posts. See: Eco-fascism Primer
Slop posts go in c/slop. Don't post low-hanging fruit here.
founded 4 years ago
MODERATORS
you are viewing a single comment's thread
view the rest of the comments
view the rest of the comments
I'm absolutely talking out of my butt now, but the US still has nukes and is OK with using them offensively. The best bet is to let a defensive war happen.
Okay do it again but this time talk out of your bidet
AAGAUUUAGUUGAGGGUGGAGAGUGGGAGGGA